ID: 1124631004_1124631013

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1124631004 1124631013
Species Human (GRCh38) Human (GRCh38)
Location 15:31337149-31337171 15:31337175-31337197
Sequence CCATGTCCCTCTCCCACTAGGCA TAAGTGGCCTGCGGCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 290} {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!