ID: 1124631006_1124631013

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1124631006 1124631013
Species Human (GRCh38) Human (GRCh38)
Location 15:31337156-31337178 15:31337175-31337197
Sequence CCTCTCCCACTAGGCATGCTAAG TAAGTGGCCTGCGGCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 91} {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!