ID: 1124640036_1124640050

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1124640036 1124640050
Species Human (GRCh38) Human (GRCh38)
Location 15:31391613-31391635 15:31391653-31391675
Sequence CCGCCCCCGACGCTTCCGGGAGG GGCCGGTCCGAAACGGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 107} {0: 1, 1: 1, 2: 0, 3: 0, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!