ID: 1124640364_1124640381

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1124640364 1124640381
Species Human (GRCh38) Human (GRCh38)
Location 15:31392823-31392845 15:31392858-31392880
Sequence CCGCCCCCGCCCCCGCCCGCGAC TCTAGGCGGCTGCCGTGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 155, 3: 547, 4: 2943} {0: 1, 1: 1, 2: 0, 3: 9, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!