ID: 1124640372_1124640384

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1124640372 1124640384
Species Human (GRCh38) Human (GRCh38)
Location 15:31392833-31392855 15:31392875-31392897
Sequence CCCCGCCCGCGACGCTTCCGGGA AGCCGGTCCGAAACGGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 54} {0: 1, 1: 1, 2: 0, 3: 1, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!