ID: 1124640376_1124640387

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1124640376 1124640387
Species Human (GRCh38) Human (GRCh38)
Location 15:31392838-31392860 15:31392887-31392909
Sequence CCCGCGACGCTTCCGGGAGGTCT ACGGCTCTAGGTGCACTGTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 56} {0: 1, 1: 1, 2: 0, 3: 3, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!