|
Left Crispr |
Right Crispr |
| Crispr ID |
1124642788 |
1124642795 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:31407001-31407023
|
15:31407039-31407061
|
| Sequence |
CCTTTTTCCATGTGAGATAACAT |
GGATTAGGATGTGACATCTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 65, 3: 369, 4: 1369} |
{0: 1, 1: 2, 2: 18, 3: 70, 4: 287} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|