ID: 1124653427_1124653436

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1124653427 1124653436
Species Human (GRCh38) Human (GRCh38)
Location 15:31488979-31489001 15:31489023-31489045
Sequence CCTGCTGGGTTCTGCCTTGACGT GCTGCAGGGCAGACACACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128} {0: 1, 1: 1, 2: 2, 3: 51, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!