ID: 1124654605_1124654614

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1124654605 1124654614
Species Human (GRCh38) Human (GRCh38)
Location 15:31498201-31498223 15:31498251-31498273
Sequence CCCTCTCTGTGTAACTGGGCACC CTTCATTGAGTTTTGCAGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 211} {0: 1, 1: 0, 2: 2, 3: 21, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!