ID: 1124678044_1124678051

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1124678044 1124678051
Species Human (GRCh38) Human (GRCh38)
Location 15:31704299-31704321 15:31704346-31704368
Sequence CCCACTCCTGGAGACCCTTTACA CCTTAAGTACTGCCTGTATCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 99} {0: 2, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!