ID: 1124696661_1124696673

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1124696661 1124696673
Species Human (GRCh38) Human (GRCh38)
Location 15:31870001-31870023 15:31870041-31870063
Sequence CCGCGGGGACCCACGCAGTCACA GCGGCCTCGCGCGCGGCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114} {0: 1, 1: 0, 2: 0, 3: 17, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!