ID: 1124713465_1124713467

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1124713465 1124713467
Species Human (GRCh38) Human (GRCh38)
Location 15:32033977-32033999 15:32034002-32034024
Sequence CCTGTTGTAGACTTTGACAAATT GAGAATTAACAGAAAGATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 201} {0: 1, 1: 0, 2: 4, 3: 43, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!