ID: 1124750532_1124750539

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1124750532 1124750539
Species Human (GRCh38) Human (GRCh38)
Location 15:32368686-32368708 15:32368711-32368733
Sequence CCCCCTCATTTGTTTTCTCCTTC AAGGCTGAGGATCCAGCTCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!