ID: 1124755299_1124755306

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1124755299 1124755306
Species Human (GRCh38) Human (GRCh38)
Location 15:32400394-32400416 15:32400425-32400447
Sequence CCTCTTACCTCCAGATCTTTCAG ATGATGTAGGGCCTTCCCTGTGG
Strand - +
Off-target summary {0: 10, 1: 12, 2: 24, 3: 28, 4: 252} {0: 8, 1: 0, 2: 4, 3: 14, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!