ID: 1124764570_1124764576

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1124764570 1124764576
Species Human (GRCh38) Human (GRCh38)
Location 15:32478201-32478223 15:32478221-32478243
Sequence CCACACTTCCCACTGTTGAAAAG AAGGCTAAAAAGAAGGAAGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 18, 4: 216} {0: 2, 1: 0, 2: 8, 3: 114, 4: 1269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!