ID: 1124780376_1124780378

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1124780376 1124780378
Species Human (GRCh38) Human (GRCh38)
Location 15:32625961-32625983 15:32625983-32626005
Sequence CCTATTCTAGATGAGAAGGATGC CTATGAAGAAAGGTTTGTGTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 130} {0: 2, 1: 0, 2: 1, 3: 26, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!