ID: 1124788262_1124788264

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1124788262 1124788264
Species Human (GRCh38) Human (GRCh38)
Location 15:32701890-32701912 15:32701920-32701942
Sequence CCAGGAGTATATCTTGAGAAAGT TTTGAAGCCTCCTGAAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!