ID: 1124803049_1124803061

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1124803049 1124803061
Species Human (GRCh38) Human (GRCh38)
Location 15:32853779-32853801 15:32853819-32853841
Sequence CCTCCTTTGGTTACGTAGCCCCA GGCCAGGCCCAGAGTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 43} {0: 1, 1: 1, 2: 9, 3: 95, 4: 671}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!