ID: 1124831360_1124831375

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1124831360 1124831375
Species Human (GRCh38) Human (GRCh38)
Location 15:33153093-33153115 15:33153139-33153161
Sequence CCAAGCTCTTTTCCAAAGTTTCC TGCTCTGAGGAAGGCCGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 43, 4: 442} {0: 1, 1: 0, 2: 3, 3: 28, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!