ID: 1124876819_1124876822

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1124876819 1124876822
Species Human (GRCh38) Human (GRCh38)
Location 15:33602647-33602669 15:33602692-33602714
Sequence CCTTTATGTTTTGTAATGAAAAT AGAACTTGATCAAGTGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 690} {0: 1, 1: 0, 2: 2, 3: 18, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!