ID: 1124877334_1124877343

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1124877334 1124877343
Species Human (GRCh38) Human (GRCh38)
Location 15:33607370-33607392 15:33607410-33607432
Sequence CCTGGGCACTTCAGGTGGGCCTG ACGGTTTTTCCTCTTGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 252} {0: 1, 1: 0, 2: 0, 3: 8, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!