ID: 1124882936_1124882945

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1124882936 1124882945
Species Human (GRCh38) Human (GRCh38)
Location 15:33659067-33659089 15:33659108-33659130
Sequence CCATGTTGGTTGTCATGACTGTG GCTGATGTGCAGTGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149} {0: 1, 1: 0, 2: 3, 3: 33, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!