|
Left Crispr |
Right Crispr |
| Crispr ID |
1124883296 |
1124883307 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:33661500-33661522
|
15:33661541-33661563
|
| Sequence |
CCAGGGACTGGTTTCATGGAAGA |
TGGTGGGTGAGGCTGGGGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 325, 1: 560, 2: 1171, 3: 1237, 4: 1212} |
{0: 1, 1: 1, 2: 19, 3: 234, 4: 2267} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|