ID: 1124887214_1124887224

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1124887214 1124887224
Species Human (GRCh38) Human (GRCh38)
Location 15:33698447-33698469 15:33698475-33698497
Sequence CCAGCTCCCTCATAAGGAGCCCG GGGGGAGCTCCTGTTGCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 99} {0: 1, 1: 0, 2: 1, 3: 10, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!