ID: 1124889118_1124889122

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1124889118 1124889122
Species Human (GRCh38) Human (GRCh38)
Location 15:33715718-33715740 15:33715744-33715766
Sequence CCATGTTGCTGCATCCTCTGGAG AGGAACACTGTGTCCTCACATGG
Strand - +
Off-target summary {0: 20, 1: 59, 2: 144, 3: 207, 4: 469} {0: 32, 1: 86, 2: 204, 3: 394, 4: 763}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!