|
Left Crispr |
Right Crispr |
Crispr ID |
1124889118 |
1124889122 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:33715718-33715740
|
15:33715744-33715766
|
Sequence |
CCATGTTGCTGCATCCTCTGGAG |
AGGAACACTGTGTCCTCACATGG |
Strand |
- |
+ |
Off-target summary |
{0: 20, 1: 59, 2: 144, 3: 207, 4: 469} |
{0: 32, 1: 86, 2: 204, 3: 394, 4: 763} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|