ID: 1124952375_1124952378

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1124952375 1124952378
Species Human (GRCh38) Human (GRCh38)
Location 15:34336127-34336149 15:34336144-34336166
Sequence CCAAAATACCCATTTCATTTCTA TTTCTAAGAAGACAAAAATGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 41, 4: 445} {0: 1, 1: 0, 2: 7, 3: 98, 4: 1294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!