ID: 1124955264_1124955274

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1124955264 1124955274
Species Human (GRCh38) Human (GRCh38)
Location 15:34356118-34356140 15:34356162-34356184
Sequence CCTTTAGCAGTGCCCTGGGAAGG AGATGACAGAGGTACCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 202} {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!