ID: 1124966665_1124966672

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1124966665 1124966672
Species Human (GRCh38) Human (GRCh38)
Location 15:34437231-34437253 15:34437246-34437268
Sequence CCAGCGGCGGCCTCCCCGCAGCC CCGCAGCCCCGCCGAGTCCGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 6, 3: 56, 4: 463} {0: 2, 1: 0, 2: 1, 3: 14, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!