ID: 1124975578_1124975579

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1124975578 1124975579
Species Human (GRCh38) Human (GRCh38)
Location 15:34527082-34527104 15:34527095-34527117
Sequence CCTTTAAACAGCTCTAAGTGTCA CTAAGTGTCAGTACTCATAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 17, 4: 142} {0: 1, 1: 14, 2: 8, 3: 22, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!