ID: 1124975578_1124975580

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1124975578 1124975580
Species Human (GRCh38) Human (GRCh38)
Location 15:34527082-34527104 15:34527130-34527152
Sequence CCTTTAAACAGCTCTAAGTGTCA TAATAAACAGTGCACACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 17, 4: 142} {0: 13, 1: 4, 2: 10, 3: 7, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!