ID: 1124975803_1124975809

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1124975803 1124975809
Species Human (GRCh38) Human (GRCh38)
Location 15:34528448-34528470 15:34528469-34528491
Sequence CCTCCAGGAGGTCCATAAGGCCG CGCTCTGGAGCCAAAATAATGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 5, 3: 13, 4: 83} {0: 9, 1: 13, 2: 5, 3: 6, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!