ID: 1124977157_1124977172

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1124977157 1124977172
Species Human (GRCh38) Human (GRCh38)
Location 15:34536187-34536209 15:34536220-34536242
Sequence CCACCCACTCTGAGAGAGGGGAG CTCTGGGAGAGTGGAGGGGCTGG
Strand - +
Off-target summary {0: 2, 1: 17, 2: 23, 3: 150, 4: 330} {0: 2, 1: 3, 2: 14, 3: 102, 4: 701}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!