ID: 1124988208_1124988215

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1124988208 1124988215
Species Human (GRCh38) Human (GRCh38)
Location 15:34644209-34644231 15:34644245-34644267
Sequence CCTCAAATCTATTTCCCTGAGGA GTTTTTAAAGGGATCATCGAAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 33, 3: 99, 4: 362} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!