ID: 1125045019_1125045026

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1125045019 1125045026
Species Human (GRCh38) Human (GRCh38)
Location 15:35235230-35235252 15:35235258-35235280
Sequence CCAGGGGTAGGAAAGTCCAGTTC CCTTGGTTTGGACAACCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 124} {0: 1, 1: 0, 2: 1, 3: 8, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!