ID: 1125063223_1125063228

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1125063223 1125063228
Species Human (GRCh38) Human (GRCh38)
Location 15:35449902-35449924 15:35449944-35449966
Sequence CCTTGTTATTTCAGAGATCTGCA AGGTACATGATTTAGGCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 348} {0: 1, 1: 0, 2: 1, 3: 7, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!