ID: 1125172000_1125172007

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1125172000 1125172007
Species Human (GRCh38) Human (GRCh38)
Location 15:36776225-36776247 15:36776272-36776294
Sequence CCTCACAGATTTAGGATATGTCA TGTATTGGAGAGAATATTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 187} {0: 1, 1: 0, 2: 1, 3: 24, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!