ID: 1125172191_1125172195

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1125172191 1125172195
Species Human (GRCh38) Human (GRCh38)
Location 15:36778212-36778234 15:36778227-36778249
Sequence CCTGAAGCTACTGACCCCCACAG CCCCACAGATGCCTCAGATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149} {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!