ID: 1125191960_1125191965

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1125191960 1125191965
Species Human (GRCh38) Human (GRCh38)
Location 15:37003850-37003872 15:37003875-37003897
Sequence CCCTTCTGCCATATGAGGACATA GAGACGGCTGTCTCTACACCGGG
Strand - +
Off-target summary {0: 3, 1: 28, 2: 288, 3: 774, 4: 1634} {0: 1, 1: 0, 2: 0, 3: 4, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!