ID: 1125193065_1125193070

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1125193065 1125193070
Species Human (GRCh38) Human (GRCh38)
Location 15:37015746-37015768 15:37015787-37015809
Sequence CCTGTGCAGTGCAACATAGAGCA GGGAATTTTGCAGCTTCACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104} {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!