ID: 1125200206_1125200220

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1125200206 1125200220
Species Human (GRCh38) Human (GRCh38)
Location 15:37096105-37096127 15:37096135-37096157
Sequence CCATATTTATCTCCACTTCCAAT CAGGCTCAGGGATGGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 332} {0: 1, 1: 1, 2: 7, 3: 125, 4: 1070}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!