ID: 1125210428_1125210433

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1125210428 1125210433
Species Human (GRCh38) Human (GRCh38)
Location 15:37208547-37208569 15:37208596-37208618
Sequence CCATCATAGTGCTGGGATCCCTA ACAGAAATAAGGACTGACAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 23, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!