ID: 1125241514_1125241520

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1125241514 1125241520
Species Human (GRCh38) Human (GRCh38)
Location 15:37582251-37582273 15:37582267-37582289
Sequence CCCTCCGGACTCTGGGCACTGAG CACTGAGGAGCACTGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 95, 4: 284} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!