ID: 1125247415_1125247419

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1125247415 1125247419
Species Human (GRCh38) Human (GRCh38)
Location 15:37657119-37657141 15:37657165-37657187
Sequence CCATAAAACTCCTAGAAGAAGAC TGACCCAGGCAAAGATTTTTTGG
Strand - +
Off-target summary {0: 2, 1: 57, 2: 1024, 3: 15538, 4: 6311} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!