ID: 1125271563_1125271565

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1125271563 1125271565
Species Human (GRCh38) Human (GRCh38)
Location 15:37944435-37944457 15:37944454-37944476
Sequence CCATGATGGTTCAATGACCTAGT TAGTGATGTCTGAGCAACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86} {0: 1, 1: 0, 2: 2, 3: 11, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!