ID: 1125322595_1125322599

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1125322595 1125322599
Species Human (GRCh38) Human (GRCh38)
Location 15:38504531-38504553 15:38504544-38504566
Sequence CCACTCCACATCTTATCCTATTG TATCCTATTGGAAGGTCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 218} {0: 1, 1: 0, 2: 12, 3: 124, 4: 680}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!