ID: 1125360939_1125360943

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1125360939 1125360943
Species Human (GRCh38) Human (GRCh38)
Location 15:38864352-38864374 15:38864390-38864412
Sequence CCTGGTGTGGGTAGCTCCAGGTC CAAGAGGAATAAAAAGTTAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 60, 4: 634}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!