ID: 1125365318_1125365321

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1125365318 1125365321
Species Human (GRCh38) Human (GRCh38)
Location 15:38907979-38908001 15:38907997-38908019
Sequence CCATCATCACTCCAGGCCAACTG AACTGATCATTACCACCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 205} {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!