ID: 1125431019_1125431028

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1125431019 1125431028
Species Human (GRCh38) Human (GRCh38)
Location 15:39593550-39593572 15:39593597-39593619
Sequence CCAACCCCACGAGGGCTCAGGGA GTAAACTCCACCACAGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 248} {0: 1, 1: 1, 2: 0, 3: 13, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!