ID: 1125436893_1125436899

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1125436893 1125436899
Species Human (GRCh38) Human (GRCh38)
Location 15:39655715-39655737 15:39655729-39655751
Sequence CCATCCTCCTTATTCAGATGCCC CAGATGCCCTACTGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 283} {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!