ID: 1125438960_1125438963

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1125438960 1125438963
Species Human (GRCh38) Human (GRCh38)
Location 15:39680545-39680567 15:39680564-39680586
Sequence CCCTAGTTAGAATCTGATTGAAA GAAATGGTCAGAGCCATCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 182} {0: 1, 1: 0, 2: 4, 3: 7, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!